Активирани ц-кит рецептор у срцу поспешује обнављање и регенерацију срца након повреде | ћелијска смрт и болест

Активирани ц-кит рецептор у срцу поспешује обнављање и регенерацију срца након повреде | ћелијска смрт и болест

Anonim

Субјекти

  • Регенерација срца
  • Кардиоваскуларне болести
  • Ћелијска смрт
  • Диференција матичних ћелија

Апстрактан

Улога ендогене активације ц-Кит рецептора у хомеостази и поправљању срчаних ћелија остаје у великој мери неистражена. Генерирани су трансгени мишеви који носе мутацију активирајуће тачке (ТгД814И) у киназном домену ц-Кит гена. ц-Кит ТгД814И рецептор експримиран је у срцу током ембрионалног развоја и постнаталног живота, у сличном временском и експресијском обрасцу као код ендогеног гена, али не у хематопоетском одељењу што омогућава проучавање срчано специфичног фенотипа. мутација ц-Кит ТгД814И произвела је конститутивни активни ц-Кит рецептор у срчаном ткиву и ћелијама трансгених мишева, што је доказано повећаном фосфорилацијом ЕРК1 / 2 и АКТ, који су главни низводни молекуларни ефектори сигнализације ц-Кит рецептора. У трансгених срца одраслих, срчана морфологија, величина и укупни ц-Кит + број срчаних ћелија није се разликовао у поређењу са вт мишевима. Међутим, када су ц-Кит ТгД814И мишеви подвргнути трансмуралним некротичним оштећењима срца криоињуријом (ЦИ), сви трансгени су преживели, у поређењу са половином тежинских мишева. У суб-акутној фази након ЦИ, трансгенични и тежински мишеви показали су слично оштећење срца. Међутим, 9 дана након ЦИ, трансгенични мишеви су показали повећан број ц-Кит + ЦД31 + ендотелних ћелија потомства који окружују некротично подручје. Касније праћење, код трансгених у поређењу са мт мишевима, примећено је константно смањење фибротичке површине, повећана густина капилара и повећана стопа напуњености кардиомиоцита (утврђено БрдУ уградњом). Доследно, ЦД45 - ц-Кит + срчане матичне ћелије изоловане из трансгеничних ц-Кит ТгД814И мишева показали су појачан потенцијал диференцијације ендотела и кардиомиоцита у поређењу са ћелијама изолованим из мас. Конститутивна активација ц-Кит рецептора код мишева повезана је с повећаним срчаним миогеним и васкуларним репаративним потенцијалом након повреде, уз значајно побољшање преживљавања.

Главни

ц-Кит је рецептор за тирозин киназу неопходан за пролиферацију, преживљавање и миграцију неколико типова матичних ћелија као што су прекурсори меланоцита, хематопоетске и матичне ћелије клица. Недавно је објављено да се ц-Кит рецептор експримира у матичним ћелијама срца и неурона. 5, 6 Мишеви којима недостаје ц-Кит ген представљају оштећења клија и ћелија меланоцита и умиру у првим данима постнаталног живота због оштећене хематопоезе. 7, 8 Везивање ц-Кит лиганда (КЛ) индукује хомодимеризацију рецептора и аутофосфорилацију интрацелуларних домена тирозин киназе, што доводи до модулације различитих сигналних путева као што су АКТ и МАПК. 9, 10, 11

У посљедњих 15 година, неколико студија је показало да ц-Кит + матичне ћелије срца (ЦСЦ) имају корисне ефекте у обнављању и регенерацији срца. 12 Мишеви генетски мутирани са недостатком ц-Кит сигнализације ( В / Вв ) показују погоршану срчану ремоделацију након инфаркта миокарда, обрнуто трансгенични мишеви који прекомерно изражавају КЛ у срцу, показују побољшано поправљање миокарда у поређењу са њиховим вт литтерматес после инфаркта миокарда. 13, 14, 15 Појачана експресија КЛ која се јавља у исхемичном срцу погодује миграцији ц-Кит + добијене коштане сржи и ЦСЦ-а активацијом п38 МАПК. 16, 17, 18 Поред тога, ц-Кит + ЦСЦ недавно су коришћени у лечењу пацијената са исхемијском кардиомиопатијом и затајењем срца са значајним побољшањем систоличке функције и смањењем величине инфаркта. 19, 20, 21

Иако се ц-Кит широко користи као 'маркер ћелијске површине' за идентификацију матичних ћелија из ембрионалног, као и срца одраслих, 22, 23 мало информација 14, 15 доступно је о функцији коју ц-Кит сигнализација има у активирању ЦСЦ у поправку срца.

Да би се истражила улога ц-Кит-а у поправљању срца, створени су трансгени мишеви који су мутирали верзију ц-Кит гена. Супституција тирозина аспартанском киселином 814 у домену фосфотрансферазе доводи до конститутивне активације рецептора. Смањена фибротичка област у криоињудираним срцима, смањена упална мијелоидна ћелија у крви, повећан број ц-Кит + ЦД31 + ендотелних ћелија и изоелектина Б4 (ИБ-4) обележених капилара као и БрдУ-позитивни новоформирани кардиомиоцити у оштећеном подручју срца примећени су трансгени мишеви. Активација МАПК и АКТ је значајно побољшана у срцима и ЦСЦ трансгених мишева, при чему две киназе модулирају активацију и ендотелну / миогену диференцијацију ЦСЦ-а. Свеукупно, ови подаци показују да активирани ц-Кит рецептор има благотворну заштитну / регенеративну улогу за ткиво миокарда након повреде побољшавајући ремоделирање и поправљање срца, док подстиче диференцијацију срчаних прогениторних ћелија вероватно услед активације сигнала МАПК и АКТ.

Резултати

Генерација трансгених мишева који изражавају активирани ц-Кит рецептор у срцу

Да би се генерирали трансгени мишеви који изражавају конститутивно активирани ц-Кит рецептор, коришћена је метода реконструкције бактеријског вештачког хромозома (БАЦ) која омогућава транскрипцију ц-Кит гена ендогеним регулаторним секвенцама (Слика 1).

Image

Д814И супституција индукује конститутивну ц-Кит активацију. ( а ) Паралелно локално поравнавање ц-Кит протеинских секвенција хуманих ( Хомо сапиенс ) и мишјих ( Мус мусцулус ) око окружења наводних остатака ради конститутивне активације у другој домени рецептора за киназу. ( б ) секвенцијални хроматограм који показује мутацију аспарагинске киселине до тирозина уведене у ц-Кит мишу БАЦ РП23-309Ц11. ( ц ) ВБ и дензитометрија израза ц-Кит на срцима сакупљеним из ембриона у различитим фазама развоја. Мутант ц-Кит протеин је експресиониран 2, 5 пута више него ендогени ниво у ц-Кит ТгД814И ц-Кит +/− ембрионима. ( д ) ВБ и дензитометрија експресије ц-Кит на укупном срчаном лизату прикупљеном од новорођених мишева. Мутантни ц-Кит протеин је експримиран 2, 5 пута више од нивоа ендогеног ц-Кит протеина код ц-Кит ТгД814И ц-Кит +/− мишева. ц-Кит активација је приказана пан-фосфо-тирозин антителом које препознаје специфични опсег на висини рецептора. ( е ) ВБ анализа на срцима прикупљеним од 7 дпп мишева. Подаци се добијају из најмање три одвојена срца и извештавају о ± СД; ** П <0, 01, *** П <0, 001. ( ф ) Имунофлуоресцентна анализа ц-Кит + ћелија (црвена) у изолованим ц-Кит ТгД814И неонаталним миоцитима, култивисана током 24 сата, обојеним са МЕФ2Ц (зелена) и МФ20 (зелена). Нуклеи (плави) су супротстављени Хоецхст 33342. Линија скале 30 µм

Слика пуне величине

У људи је пронађено да је 816 аспартанске аминокиселине друге киназне домене ц-Кит супституирано активирајућим мутацијама у неколико тумора (Слика 1а). 24, 25, 26 Одговарајући мишји 814 аспартички остатак је успешно мутиран на тирозин (Д814И) у мишјем БАЦ (РП23-309Ц11) што је потврђено анализом секвенци (слике 1а). Добијени БАЦ је потом коришћен за генирање трансгених мишева. Произведено је неколико оснивачких линија, од којих су две (Тг7 и Тг8) преносиле и на сличан начин изражавале конститутивни активни ц-Кит рецептор (ц-Кит ТгД814И ).

Трансгени мишеви су укрштени са ц-Кит дивљим типом ( ц-Кит + / + ) или ц-Кит хетерозиготним ( ц-Кит + / - ) мишевима. У ембрионалном (Слика 1ц) и неонаталном (Слика 1д и Слика 2б) срца трансгених мишева изразила је рецептор 2, 5 пута више у поређењу са контролним мишевима, што указује да је експресија протеина ц-Кит ТгД814И слична ендогеним нивоима ц-Кит рецептора. + / + мишеви. У доби од једне недеље, ц-Кит рецептор може се лако открити анализом западног блотирања (ВБ) на укупним срчаним лизатама ц-Кит ТгД814И ц-Кит +/− мишева, али не и са ц-Кит +/− мишева у којима откривен је само имунопреципитацијом (слика 1е, допунска слика 1А). Да би се потврдило да ли је увођење мутације Д814И изазвало активирање ц-Кит рецептора, у антителофосфору је коришћено пан антитело против фосфо-тирозина у ВБ анализама, што омогућава детекцију свих могућих места аутофосфорилације рецептора. Слике 1д и е показују повећану фосфорилацију тирозина у протеинској траци која одговара ц-Кит рецептору у трансгеничним срцима у поређењу са хетеророзним срцима. Ови резултати су потврђени у срцима ц-Кит ТгД814И ц-Кит + / + мишева (Слика 2ц и подаци нису приказани). Да би се додатно окарактерисала експресија трансгена, изоловане неонаталне срчане ћелије из ц-Кит ТгД814И ц-Кит +/- мишева су добијене и култивисане током 24 сата пре бојења имунофлуоресценцијом. Слика 1ф показује да је ц-Кит изражен у миоцитним потомцима, што је откривено заједничким бојењем са МЕФ2Ц маркером (слика 1ф, горњи панели), али не у крајње диференцираним миоцитима као што је приказано бојењем МФ20 (слика 1ф, доњи панели). Ови резултати показују да експресија конститутивно активираног рецептора не спречава нормалну диференцијацију миоцита и не индукује ектопичну експресију ц-Кит у диференцираним миоцитима. Експресија и активирање трансгених протеина су такође примећени у тестисима и можданим цревима у различитим узрастима (допунска слика 1Б). Ови подаци потврђују да се транскрипција гена ц-Кит , методом реконституције БАЦ, одвијала под ендогеним регулаторним механизмима код ових типова ћелија.

Image

МАПК и АКТ активација у ц-Кит ТгД814И трансгеничним срцима. ( а ) Изолована су срца и јетра из ц-Кит ТгД814И ц-Кит - / - и ц-Кит - / - Е15.5 и протеински екстракти су анализирани на АКТ и МАПК фосфорилацију. Фосфорилирани супстрати су повећани у ембрионалним срцима од трансгених мишева. ( б ) ВБ анализа протеинских екстраката из ц-Кит ТгД814И ц-Кит + / + и ц-Кит + / + 3 дпп срца двеју различитих животиња. Пријављена је дензитометрија ц-Кит експресије, МАПК и АКТ фосфорилација. Подаци су наведени као средња вредност три срца ± СД; * П <0, 05, ** П <0, 01, *** П <0, 001. ( ц ) Неонаталне срчане ћелије изоловане из ц-Кит ТгД814И ц-Кит + / + и ц-Кит + / + 3 дпп срца су стимулисане са 100 нг / мл КЛ у трајању од 10 мин и екстрактом протеина за фосфорилацију АКТ и МАПК. Извештава се о дензитометрији шест засебних експеримената. Подаци су наведени ± СД; * П <0, 05, ** П <0, 01

Слика пуне величине

Активирани ц-Кит ТгД814И рецептор није експримиран у хематопоетским деловима

ц-Кит нокаут мишеви умиру након рођења због тешког оштећења хематопоезе. Мутирани и конститутивно активни протеин ц-Кит рецептора није детектиран у коштаној сржи одраслих анализама ВБ и проточне цитометрије (допунске слике 1Ц и Д). Ово може одражавати пријављено одсуство експресије БАЦ конструкције у ћелијама коштане сржи. 27

Да бисмо детаљно проучили експресију ц-Кит ТгД814И трансгена у хематопоетским деловима, генерисали смо мишеве са оштећењем ц-Кит (ц-Кит - / - ; Допунска слика 1Е) и реконституисали смо их трансгеном ( ц-Кит ТгД814И ц -Кит - / - ). Слично као и ц-Кит - / - ембриони и новорођенчад, ц-Кит ТгД814И ц-Кит - / - младићи су били изузетно анемични, мањи од својих легла и сви су умрли пре рођења (допунска слика 1Е), што указује да трансгени не спасавају спас смртоносни фенотип ц-Кит кноцкоут мишева. Смртоносност ц-Кит ТгД814И ц-Кит - / - узрокована је недостатком експресије трансгена у јетри фетуса. Маргинални ц-Кит израз, недовољан за спашавање фенотипа, примећен је и у ц-Кит - / - и ц-Кит ТгД814И ц-Кит - / - јетри из Е15.5 вероватно због стратегије коришћене за ц-Кит - / - генерација миша (Додатне слике 1Ф и Г и одељак о методама). Супротно томе, имунофлуоресцентна анализа открила је експресију трансгена ц-Кит у ембрионалном ц-Кит ТгД814И ц-Кит - / - срчаном ткиву, док, као што се очекивало, није примећена никаква експресија код ц-Кит - / - ембриона (допунска слика 1Ф). Експресија трансгена ц-Кит у срцу осим главе, грана и лука такође је примећена у ранијем периоду развоја (допунска слика 1Г). Ова запажања проширују знање о експресији ц-Кит на рани развој срца 28, 29 и такође указују на важну предоџбу да се ц-Кит ТгД814И трансген изражава у срцу, али не у хематопоетском ткиву фетуса и одраслих. Дакле, овај трансгени модел миша нуди јединствену предност у односу на претходне моделе миша, јер искључује да је било који срчани фенотип секундарни активираном ц-Кит рецептору у ћелијама коштане сржи.

Активирани ц-Кит рецептор индукује ЕРК1 / 2 и АКТ фосфорилацију

ц-Кит рецептор силазном сигнализацијом углавном укључује МАПК и ПИ3К стазе. 10, 11, 30 Да би се проценило да ли су ови путеви активирани у ц-Кит ТгД814И мишевима, оцењени су Е15.5 ц-Кит ТгД814И ц-Кит - / - и ц-Кит - / - ЕРК1 / 2 и АКТ фосфорилација (слика 2а). Нису примећени различити нивои фосфорилације ЕРК1 / 2 и АКТ у екстрактима јетре из ц-Кит ТгД814И ц-Кит - / - у поређењу са обореним мишевима (слика 2а), како се и очекивало због одсуства трансгене трансгена у јетри (допунска слика 1Ф ). Супротно томе, у срчаним узорцима ц-Кит ТгД814И ц-Кит - / - мишева примећено је мало, али значајно повећање фосфорилације АКТ и снажно повећање фосфорилације ЕРК1 / 2 у поређењу са мишевима ц-Кит - / - (Слика 2а) . Слична повећања ЕРК1 / 2 и АКТ фосфорилације примећена су у укупним срчаним лизатима мишева с 3 дпп ц-Кит ТгД814И ц-Кит + / + у поређењу са м-ц-Кит + / + (Слика 2б). Поред тога, већа фосфорилација ЕРК1 / 2 и АКТ примећена је и код трансгеничног ц-Кит ТгД814И ц-Кит + / + у поређењу са ц-Кит + / + свеже изолованим препаратима срчане ћелије за новорођенчад (Слика 2ц). Интересантно је да активирање ц-Кит-а од стране његовог ендогеног лиганда (КЛ) индукује ЕРК1 / 2 и АКТ фосфорилацију у ћелијама изолованим од вт срца до нивоа откривеног у ћелијама трансгена. Штавише, КЛ није успео даље да повећа ниво ЕРК1 / 2 и АКТ фосфорилације у срчаним ц-Кит + ћелијама изолованим од трансгених животиња (Слика 2ц). Ови резултати показују да су МАПК и ПИ3К путеви активирани у срцима ц-Кит ТгД814И мишева који опонашају ендогену стимулацију лиганда. Пре третмана Иматинибом успело је да спречи КЛ стимулацију вт ћелија, потврђујући селективност активације ц-Кит / КЛ система (допунска слика 2А). Као што се очекивало, Иматиниб није утицао на ц-Кит ТгД814И ћелије, услед конформационих промена изазваних мутацијом које модификују каталитички домен (допунска слика 2А).

Коначно, као доказ принципа конститутивне активације ц-Кит ТгД814И рецептора, трансгени мишеви који изражавају вт верзију ц-Кит рецептора (ц-Кит ТгВТ ) са оригиналног БАЦ РП23-309Ц11 су прешли на Ц57 / БЛ6 мишеве за процена ц-Кит експресије и активације. Као што је приказано на Додатној слици 2Б, срца са ц-Кит ТгВТ мишева изразила су двоструко већу количину рецептора у поређењу с контролним лисицама, али није утврђена разлика у аутофосфорилацији или активираном сигналном путу ЕРК1 / 2 и АКТ.

Експресија ц-Кит рецептора не утиче на развој и морфологију срца

Да бисмо проценили ефекте активације ц-Кит рецептора на срчано ткиво и структуру, прво смо утврдили да ли је конститутивна активација ц-Кит утицала на број укупних срчаних ц-Кит + ћелија у мутираним мишевима ц-Кит ТгД814И . Да бисмо поједноставили очитавање квантитативне имунохистохемије и ФАЦС анализе, укрстили смо мутиране мишеве ц-Кит ТгД814И са трансгеничним мишевима који експримирају ЕГФП под регулаторним редоследом ц-Кит промотора ( пКит ЕГФП ). 31, 32

У ц-Кит ТгД814И пКит ЕГФП двоструко трансгених срца, већина (преко 95%) ћелија која експримирају ц-Кит идентификована је бојењем анти-ц-Кит антителом коекспримираним ЕГФП протеином (слика 3а). Хистолошка анализа срчаног одсека са мишева на 1 дпп, 10 дпп и 2 месеца показала је да се ц-Кит + ЕГФП + ћелије дистрибуирају дуж епикарда, шире у миокард и ређе су груписане у ендокардијуму. Важно је да је број ЕГФП + ћелија био упоредив у ц-Кит ТгД814И пКит ЕГФП срцима и пКит ЕГФП у свим временским тачкама (Слика 3б). Поред тога, густина капилара миокарда и величине миоцита били су слични код ц-Кит ТгД814И пКит ЕГФП и пКит ЕГФП срца (подаци нису приказани). Дакле, ови подаци показују да конститутивни активирани ц-Кит рецептор не мења укупни ц-Кит + ћелијски број, васкуларизацију миокарда и раст миоцита током развоја и хомеостазу ћелија у одраслих, барем у старости коју смо истраживали.

Image

ц-Кит + на дистрибуцију срчаних ћелија не утиче мутација ц-Кит ТгД814И ин виво . ( а ) Имунофлуоресценција на деловима срца припремљена од 1 дпп, 10 дпп и одраслих ц-Кит ТгД814И пКит ЕГФП мишева који показују интрамијакардне (1 дпп и за одрасле) и пери-вазалне (10 дпп) ц-Кит + локализацију ћелија. Уметци показују ц-Кит (црвени) и ЕГФП (зелени) коекспресију. Линија скале 30 µ М. ( б ) Број ЕГФП + ћелија у ц-Кит ТгД814И пКит ЕГФП у односу на пКит ЕГФП мишеве при 1 дпп, 10 дпп и за одрасле. Најмање 20 секција анализирано је за свако срце ( н = 3 мишева за свако узраст и генотип). Одсечено је цело срце и анализирано на 1 дпп мишева. Подаци су пријављени ± СЕ; * П <0, 05

Слика пуне величине

Израз активираног ц-Кит рецептора побољшава опоравак срца након повреде

Да би се изазвала улога активираних ц-Кит ћелија у поправку миокарда, оштећење вентрикула је индуковано криоињуријом (ЦИ) у срцима трансгених и масних мишева старијих два месеца (Слика 4). Опстанак животиња, системска упала и преградња срчаног ткива су процењени како би се проценио опоравак после срчане повреде.

Image

Повећани преживљавање и смањена срчана фиброза код ц-Кит ТгД814И мутанта након ЦИ. ( а ) Каплан-Меиерова анализа преживљавања код ц-Кит + / + ( н = 20) и ц-Кит ТгД814И ( н = 12) мишева. Преживљавање ц-Кит ТгД814И мишева било је статистички значајно у поређењу са ц-Кит + / + 5 дана након повреде (100% ц-Кит ТгД814И насупрот 57% теж.). Мишеви који су умрли током операције нису узети у обзир за криву преживљавања. ( б ) Временска линија која показује узорковања крви пре и после ЦИ и прикупљање срца. Регенерација миокарда процењена је на 1, 4 и 6 недеља после ЦИ. ( ц - е ) Цитофлуориметријске анализе узорака крви прикупљених 1 недељу пре ЦИ и сваке недеље док нису убијени мишеви обојени за површинске маркере ГР-1 и ЦД11б. Репрезентативно цртање ГР-1 и ЦД11б бојења крви сакупљене од мишева ц-Кит + / + и ц-Кит ТгД814И 7 дана пре (горњи панели) и 30 дана после (доњи панели) ЦИ. ( ц ) Кривуље које представљају средње вредности ЦД11б + ГР-1 + ( д ) и ЦД11б + ГР-1 - ( е ) крвних ћелија ( н = 8 мишева за сваку групу). Подаци су наведени ± СЕ Извештава се значај у односу на прво узорковање крви било за ц-Кит + / + и ц-Кит ТгД814И , # П <0, 05. Значај између ц-Кит + / + и ц-Кит ТгД814И узорака крви је пријављен у различитим временским тачкама, * П <0, 05 ** П <0, 01. ( ф ) Репрезентативни Массон Трицхромиц обојени секције миокарда од вт и трансгеничних мишева 1 месец после миокардне лезије. Плаво, фибротично ткиво и црвени, миокарда одржив. Ваге шипке 1мм. ( г ) Хистограм који показује проценат фибротичке површине у тежинским и трансгеничним мишевима ( н = 7 и н = 9 за ц-Кит + / + и ц-Кит ТгД814И мишеве, респективно) 1 месец после ЦИ. Површине се мере помоћу ИмагеЈ софтвера. Подаци су пријављени ± СЕ ** П <0, 01

Слика пуне величине

Као што је приказано на слици 4а, 43% ц-Кит + / + мишева умрло је у року од 5 дана након повреде, док су ц-Кит ТгД814И ц-Кит + / + мишеви били отпорни на увреду јер ниједан мишев није умро након операције. Овај резултат указује да су трансгени мишеви били заштићени од акутног оштећења. Узорци крви прикупљени су 1 недељу пре повреде срца и 1, 2 и 4 недеље након оштећења ради праћења нивоа упалних ћелија у циркулацији. Релативне количине ЦД11б + Грл + и ЦД11б + Грл - мијелоидних ћелија анализиране су проточном цитометријом (слике 4б-е). Ове две подскупове мијелоидних ћелија сматране су показатељима упале ткива и ремоделирања, респективно. 33, 34 Слике 4ц-е показују протуупално ЦД11б + Гр1 + ћелије које се повећавају и у тежинским и у трансгеничним мишевима 1 недељу након оштећења. Након 2 недеље, проценат ЦД11б + Гр1 + ћелија се смањио на основну вредност откривену пре оштећења на трансгеним мишевима, док је њихов проценат остао висок у тежинским мишевима (слике 4ц и д). ЦД11б + Гр1 - проценат ћелија опао одмах након ЦИ код обе третиране животиње, али само код трансгених мишева вратио се на базни ниво у року од 2 недеље (Слике 4ц и е). Ови подаци показују да су ЦД11б + Гр1 + и ЦД11б + Грл - ћелије различито модулиране у трансгеничним мишевима у поређењу са тежинским животињама након повреде срца. Ови подаци такође сугеришу да је релативни проценат циркулирајућих ЦД11б + Грл + и ЦД11б + Грл - у крви паралелно са повећаним преживљавањем трансгених мишева у поређењу са теж.

Да би се директно процијенила штета утврђена помоћу ЦИ, мјерен је опсег фибротичке површине Массон Трицхромиц обојењем 3, 9 и 30 дана након оштећења (слике 4ф и г и додатне слике 3А и Б). Док 3 дана након оштећења није примећено фибротичко ткиво (подаци нису приказани), 9 дана након оштећења пронађено је велико миокардијално обојено подручје Массон-трихромом и у масним и у трансгеничним мишевима (допунске слике 3А и Б). У овом тренутку, сличан ниво апоптозе ћелијских зидова вентрикуларне стијенке нађен је и у вт и у трансгеничним мишевима (допунска слика 3Ц). Међутим, 30 дана након оштећења, фибротичка област била је троструко мања код трансгених мишева у поређењу са тежинским животињама (12, 83 ± 4% у односу на 4, 39% ± 2, 44%) (слике 4ф и г и допунска слика 3Д). Истодобно, 30 дана након оштећења, величина кардиомиоцита у пограничној зони трансгених мишева била је мања у поређењу с дивљим мишевима (допунска слика 3Е).

Ови резултати сугеришу да мишеви који носе конститутивно активирани ц-Кит рецептор имају предност како у акутном одговору на повреду миокарда што се показује повећаним преживљавањем, тако и у дугорочном периоду што се показује ефикаснијим поправљањем некротичног ткива.

Активирана ц-Кит рецепторска експресија појачава регенерацију ендотела и кардиомиоцита након повреде ин виво

Да бисмо разјаснили ћелијски механизам помоћу којег експресија трансгена потиче обнављање срца, истраживали смо раст и диференцијацију ћелија које експримирају ц-Кит ТгД814И после ЦИ. Извршена је имунофлуоресцентна анализа да би се идентификовао укупни срчани ц-Кит + ћелије унутар повређеног подручја 9 дана након повреде (Слика 5а). У овом тренутку, ц-Кит + ћелијски број који је показао очигледан издужени облик, био је већи код трансгених мишева у поређењу са тежинским мишевима (Слика 5б; 72 ± 9 ћелија / мм 2 и 55 ± 7 ћелија / мм2). Да бисмо верификовали стопу посвећености васкуларном роду укупних ц-Кит + ћелија, процијенили смо експресију ц-Кит заједно са ендотелним (ЦД31) и α- глатким маркерима актина глатког мишића унутар оштећеног подручја. ц-Кит + ћелије су биле практично негативне за актин глатког мишића у оба генотипа, док је више од 90% ц-Кит + ћелија обојених са ЦД31 код ц-Кит ТгД814И мишева у поређењу са ~ 60% у мт мишевима (Слике 5ц и д). Паралелно са тим, 30 дана након ЦИ, примећена је повећана густина капилара код трансгених мишева у поређењу са тежинским мишевима на пери-оштећеном подручју (Слика 5е). Коначно, трансгени и вт мишеви су имплантирани мини-осмотским пумпама за системско ослобађање БрдУ одмах након повреде током 28 дана, да би се пратила регенерација ћелија миокарда. Троструко повећање новонасталих формираних БрдУ + кардиомиоцита је примећено код трансгеничних срца у поређењу са вт мишевима током 1 месеца након некрозе миокарда помоћу ЦИ (слика 5ф). Све у свему, ови подаци сугерирају да ин виво , конститутивна активација ц-Кит рецептора у ћелијама миокарда поспјешује обнављање срца повећавајући ангиогени и миогени одговор на повреду.

Image

ц-Кит активација индукује ендотелну и срчану диференцијацију у ц-Кит ТгД814И срцима. ( а ) Имунофлуоресценција ц-Кит (црвена) 9 дана након повреде у ц-Кит ТгД814И и ц-Кит + / + одсеку срца. Вага 30 м м. ( б ) Хистограм ц-Кит + ћелија ( н = 3 одељка анализирана су за 3 различита мишева). Подаци су наведени ± СЕ ( ц ) Имунофлуоресценција за ц-Кит (црвена), ЦД31, актин глатког мишића (зелена) у ц-Кит ТгД814И и ц-Кит + / + срчаном делу 9 дана након ЦИ. Звездица означава ц-Кит појединачне позитивне ћелије. Ваге шипке 30 µм . ( д ) Хистограм ц-Кит + и ЦД31 + ћелија унутар оштећеног подручја ( н = 3 одељка анализирана су за 3 различита мишева). Подаци су пријављени ± СЕ ** П <0, 01. ( е ) Репрезентативна слика ц-Кит ТгД814И десне коморе 30 дана након ЦИ, обојене ИБ-4 (зелено). Хистограм бар граф представља промену набора ИБ-4 + ћелија која се налази у пери-оштећеном подручју ( н = 2 одељка су анализирана за 3 различита мишева). Линија скале 20 µм . Подаци су наведени ± СД * П <0, 05. ( ф ) Репрезентативна слика ц-Кит ТгД814И десне коморе 30 дана након уградње срчане ЦИ и БрдУ. Инсет показује α- актинин + / БрдУ + / ВГА + моно-нуклеавани кардиомиоцит. Вага 50 м м. Проценат БрдУ који садржи кардиомиоците је пријављен на хистограму (анализирано је н = 3 одељења за 5 различитих мишева). Подаци су наведени ± СД * П <0, 05

Слика пуне величине

Активација ц-Кит рецептора повећава активацију ЦСЦ и диференцијацију ин витро

Подаци приказани горе не могу недвосмислено успоставити директан однос прекурсора до диференцираног ћелијског производа између почињених ц-Кит + ћелија и повећаног стварања ендотелних ћелија и кардиомиоцита у трансгеничним мишевима након повреде. Стога смо директно тестирали ову хипотезу издвојили ЦД45 - ц-Кит + ЦСЦс 35 од трансгених и вт мишева одраслих ц-Кит ТгД814И (слика 6а). Када су смештене у ЛИФ-условљеном ЦСЦ медијуму, трансгеничне ћелије ц-Кит ТгД814И показале су повећан раст ћелија у поређењу са вт ЦСЦ-има, што је доказано њиховом кинетичком кривуљом раста и брзином инкорпорације БрдУ ин витро (слике 6б и ц). Тај већи потенцијал раста био је у корелацији са повећаним клоногенским потенцијалом утврђеним одлагањем једноћелија (Слика 6д). Поред тога, конститутивна активација ц-Кит рецептора је поспешила формирање ЦСЦ сфере, ин витро маркера мултипотентних ћелија, у поређењу са вт ЦСЦ (слика 6е). Ове ћелијске карактеристике ц-Кит ТгД814И ЦСЦ повезане су са активацијом ц-Кит рецептора, што је показано повећаном ЕРК1 / 2 и АКТ фосфорилацијом у трансгени у односу на вт ЦСЦ (слика 6ф). Заиста, АКТ инхибиција МК2206, познатог селективног алостерног инхибитора АКТ, и ЕРК1 / 2 инхибиција ПД98059, малог молекула селективно циљаног ЕРК1 / 2, била су у стању да смање клоногенезу и стопу сферогенезе у трансгени ц-Кит ТгД814И ЦСЦ (слике 6г и х).

Image

ЦСЦ активирају ц-Кит ТгД814И . ( а ) проточна цитометрија ЦСЦ-а изолованих из ц-Кит + / + и ц-Кит ТгД814И срца. ( б и ц ) Кривуља раста ћелије и процена инкорпорације БрдУ ц-Кит + / + и ц-Кит ТгД814И ЦСЦ . Подаци су наведени ± СД * П <0, 05. ( д и е ) Анализа формирања клона и сфере изведена је на ц-Кит + / + и ц-Кит ТгД814И ЦСЦ, а резултати су сумирани у хистограмској траци. Приказане су репрезентативне слике клонова. Подаци су наведени ± СД * П <0, 05. ( ф ) ВБ и дензитометријска анализа протеинских екстраката из ц-Кит ТгД814И и ц-Кит + / + ЦСЦ из три различита експеримента. ( г и х ) Анализа формирања клона и сфере изведена је на ц-Кит ТгД814И ЦСЦ после 14 дана лечења АКТ (МК2206, 1 μМ), ЕРК инхибитором (ПД98059, 100 µМ) или комбинацијом истих. Подаци су наведени ± СД * П <0, 05 насупрот необрађеном узорку (НТ)

Слика пуне величине

Када су ћелије прајмиране у ЛИФ-лишено кардиомиогено стање са слабим серумом (2%), ЦСЦ-и мишева ц-Кит ТгД814И показују повећану миогену спецификацију у поређењу са вт ЦСЦ-има. Заиста, повећан број транскрипција мРНА за Нкк2.5, познати фактор транскрипције кардиомиоцита и за Мих7, Ацтц1 и Тнн3, главни контрактилни гени су детектовани у ц-Кит ТгД814И у поређењу са вт ЦСЦ (слика 7а). И МК2206 и ПД98059 третман значајно су утицали на животну способност ћелија у условима миогеног диференцијације са ниским серумом, спречавајући спецификацију миогена занемаривом регулацијом горње срчане транскрипције и контрактилним геном мРНА (подаци нису приказани).

Image

Појачана ендотелна диференцијација ц-Кит ТгД814И ЦСЦ - ова . ( а ) кРТ-ПЦР на ц-Кит ТгД814И и ц-Кит + / + ЦСЦ за срчани маркер након пребацивања ћелија у медијум за диференцијацију кардиомиоцита. Подаци су изражени као пораст пута у односу на базални. Подаци су наведени ± СД * П <0, 05 насупрот базалним и # П <0, 05 у односу на ц-Кит + / + . ( б ) Полукватитативна РТ-ПЦР квантификација ендотелних маркера 3 и 10 дана након пребацивања ц-Кит ТгД814И и ц-Кит + / + ЦСЦ у ендотелни медијум. Резултати су изражени као пораст пута у односу на ГАПДХ ± СД * П <0, 05, ** П <0, 01 и *** П <0, 001. ( ц ) Ендотелна диференцијација је инхибирана 72-часовним третманом инхибитором ЕРК1 / 2 (У0, 10 µМ), али не и АКТ инхибитором (ЛИ, 10 µМ ). Подаци су наведени као промена мРНА прегиба ± СД у односу на НТ, * П <0, 05, ** П <0, 01

Слика пуне величине

С друге стране, када су ЦСЦ-ови постављени у специфични ендотелијалан медијум за диференцијацију, лишен ЛИФ-а, примећено је значајно повећање транскрипта ендотелијалне РНА ЦД31 и ВЕГФР2 у ц-Кит ТгД814И у поређењу са ц-Кит + / + ЦСЦ већ у 3 дана у диференцијацији. медијум, што је праћено током 10 дана већим бројем ЦД31 + ендотелних диференцираних ћелија (слика 7б и допунска слика 4А). Занимљиво је да је ендотелна диференцијација укинута инкубацијом са МАПК инхибитором (УО), али не и са АКТ инхибитором (ЛИ) (слика 7ц и додатна слика 4Б), што сугерише да је МАПК неопходан за диференцијацију ендотела гена, стимулисано ц-Кит.

Свеукупно, ови подаци показују да, ин витро , конститутивна активација ц-Кит рецептора делује неколико корисних ефеката на ЦСЦ, појачавајући њихово појачавање, када се примењује да се размножавају, и промовишући њихову кардиомиоцитну и ендотелну диференцијацију, када се додају за одређену обавезу срчаних ћелија.

Дискусија

У овом истраживању, створен је нови модел миша који експримира ц-Кит рецептор активирајућом аминокиселинском супституцијом за проучавање експресије и активације рецептора у развоју срца и његове улоге током регенеративних процеса. Трансгени мишеви су генерисани мутирајући БАЦ вектор који садржи ендогене регулаторне секвенце од 67 Кб узводно од почетног кодона и 58 Кб низводно од зауставног кодона. Као што је претходно описано за остале трансгене мишеве генерисане векторима који обухватају сличне регионе ц-Кит локуса, експресија трансгена 27, 36 није откривена у јетри фетуса и коштаној сржи одраслих, вероватно због недостатка региона за појачавање у регулативном редоследу БАЦ, 27, али његова експресија и активација су повећани и до два пута у поређењу са тежином у срцу, осим у мозгу и тестисима. На овај начин, било је могуће први пут проучити активност рецептора физиолошки изражену у срчаном ткиву и разјаснити контроверзне налазе извештавају о претпостављеном доприносу коштане сржи у односу на станичне ц-Кит + ћелије у поправљању срца. 18, 22, 23, 37

Ц-Кит + дивљи тип ћелије реагује на ц-Кит когнитивни лиганд повећавајући ЕРК1 / 2 и АКТ фосфорилацију. 38, 39 Занимљиво смо открили константно повећање нивоа фосфорилације ЕРК1 / 2 и АКТ у срцима и изолованим препаратима срчаних ћелија добијеним у различитим узрастима трансгених мишева. Овај ниво активације, специфичан за мутацију активирајућег гена и потврђен анализом протеина ц-Кит ТгВТ мишева, није даље стимулисан третирањем ћелија специфичним ц-Кит лигандом.

Све у свему, ови резултати подржавају и снажно потврђују да су ЕРК1 / 2 и АКТ међу главним метама ц-Кит рецептора у срчаним ц-Кит + ћелијама. Заправо, супституција аспартанске киселине 814 тирозином могла је рекапитулирати активацију ПИ3К и МАПК путева који се природно дешавају након КЛ стимулације вт рецептора, омогућавајући тако да се истражи физиолошка улога ц-Кит рецептора у срцу. 814 Аспартиц мутација раније је пронађена код различитих врста тумора и пријављено је да индукује конститутивну активацију ц-Кит. 24, 25, 26 Посебно су трансгени мишеви који носе мутацију ц-Кит ТгД814И праћени више од 2 године и нису откривени тумори као што су ГИСТ, семеном или мастоцитоза.

Потпуно карактеризација експресије ц-Кит ТгД814И у срцу изведена је од стране ВБ и имунохистохемије показујући да се активирани рецептор експримира током ембриогенезе, неонаталног и одраслог живота. БАЦ вектори, чувајући ендогену регулацију гена, дали су прилику за проучавање срчаних ц-Кит + ћелија у односу на њихово претпостављено порекло од првог срчаног поља, проепицардума или епитела до мезенхималног прелаза. Даљња карактеризација је потребна за потврду да ли су две потпопулације које изражавају ниске и високе нивое ц-Кит, недавно описане, 40, 41, 42, 43, различито регулисане у срцима ц-Кит ТгД814И мишева. Укрштањем ц-Кит ТгД814И мишева на пКит ЕГФП мишеве закључили смо да су број и локализација ц-Кит + ЕГФП + двоструко позитивних ћелија слични између пКит ЕГФП и ц-Кит ТгД814И пКит ЕГФП срца што указује на слично понашање вт и трансгених ћелије у нетакнутом органу. Ова запажања сугеришу да конститутивна активација ЕРК1 / 2 и АКТ путева ин виво не утиче на пролиферацију и / или ћелијску смрт ових ћелија у нормалним условима или да се ови догађаји дешавају у уском прозору пре него што ц-Кит + ћелије прођу диференцијацију. С друге стране, ин витро експерименти показали су бољу пролиферацију и потенцијал раста ц-Кит ТгД814И ЦСЦ пречишћених од одраслих мишева ц-Кит ТгД814И што указује да је мутација рецептора сама по себи способна у потпуности да активира програм пролиферације ових ћелија.

Да бисмо тестирали ефикасност трансгена у регенерацији срца, искористили смо ЦИ технику. 44, 45 ЦИ изабран је јер може изазвати жаришно, трансмурално и репродуктивно оштећење срца. Трансгени мишеви су били отпорнији на повреде (слика 4). Сви мишеви преживели су после ЦИ и показали су поправљање срчаног ткива у року од месец дана након оштећења, што сугерише заштитну улогу ц-Кит ТгД814И трансгена.

Штавише, примећено је конзистентно смањење фибротичке области после ЦИ код трансгених мишева (слика 4ф). Девет дана након ЦИ повећан је број ц-Кит + ћелија на оштећеном подручју ц-Кит ТгД814И мишева у поређењу са ц-Кит + / + мишевима (Слика 5б). Пошто је објављено да ЕРК1 / 2 и АКТ фосфорилација могу изазвати миграцију и / или диференцијацију матичних ћелија, 17, 39, 46, наша открића показују да би се ови механизми могли појавити и након ЦИ код ц-Кит ТгД814И мишева. Ова хипотеза је у складу са опажањем бројних издужених ц-Кит + ћелија на оштећеном подручју које изражавају ендотелни ЦД31 маркер и са већом густином капилара које се налазе у пери оштећеном подручју трансгених срца, што омогућава да се спекулише да се ц-Кит активација је потребан за формирање нових жила током ране фазе поправљања срца. Ови резултати су у складу с недавним налазима који показују да су ц-Кит + ћелије опредељене за ендотелну диференцијацију 42, 47, 48 и по први пут показују да је активирање МАПК, али не и АКТ сигналног пута, од суштинске важности за ц-Кит- посредована ендотелна диференцијација. Штавише, резултати добијени уградњом БрдУ такође сугеришу улогу ц-Кит ТгД814И рецептора у регенерацији миоцита, након што повреда срца погодује промету кардиомиоцита за обнављање срца. Ин виво бипотенцијална судбина ц-Кит ТгД814И прекурсора за подршку и ендотелне и кардиомиоцитне диференцијације потврђена је ин витро пречишћавањем и селективним култивацијом ц-Кит ТгД814И ЦСЦ- а и показујући да су за раст ЦСЦ и клоногенска својства потребни и МАПК и АКТ стази. као и за њихово ендотелно и миогено залагање. Свеукупно, ови резултати наглашавају пресудну улогу активације ц-Кит рецептора у поправљању срца с изразитим укључивањем АКТ и / или ЕРК1 / 2 сигналних путева за посредовање ц-Кит функција како код здравих, тако и код повређених срца.

Материјали и методе

Генерација мишева

Генерација трансгених мишева ц-Кит ТгД814И добијена је супституцијом Г у Т 2468 у ц-Кит гену мишјег БАЦ РП23-309Ц11 хомологном рекомбинацијом као што је претходно описано. 49, 50

The murine BAC RP23-309C11, containing 80 kb of c-Kit genome sequence and 68 kb of sequence upstream and 57 kb of sequence downstream the c-Kit initiation and stop codons, respectively, was engineered substituting the G to T 2468 to generate c-Kit TgD814Y transgenic mice. Electrocompetent DH10B bacteria with the BAC RP23-309C11 were electroporated with 100 bp oligos containing complementary 20 bp mutated regions around the G to T 2468 nucleotide responsible for the switch of aspartic to tyrosine amino acid. Following the first homologous recombination driven by a temperature-inducible mini- λ phage, a second electroporation, was performed using a 100 bp oligos pairs with the G to T 2468 substitution surrounded with endogenous c-Kit sequence to replace the first oligos pairs and leave the single point mutation. Following the second homologous recombination, the mutation was inserted in the BAC RP23-309C11. The G to T 2468 mutation was confirmed by sequencing analysis and the purified BAC was microinjected into the pronuclei of fertilized C57BL/6 eggs by standard methods. Founder lines were identified by RT-PCR analysis using Sp6 For (5′-ATTTAGGTGACACTATAG-3′) and 309 Rev (5′-CTCTTCTTGACAGTTCCTGC-3′) and CM for (5′-TGTTCACCCTTGTTACACCG-3′) and CM Rev (5′-CCACTCATCGCAGTACTGTT-3′) primers designed in between the vector and c-Kit gene and in the chloramphenicol resistance cassette, respectively.

Two transgenic founders lines, Tg7 and Tg8, were maintained by breeding them to C57BL/6 mice. Homozygotes pKit EGFP (gifted by Prof Ottolenghi, 31 ) were crossed with c-Kit TgD814Y c-Kit +/+ to generate c-Kit TgD814Y c-Kit +/+ pKit EGFP mice (referred as c-Kit TgD814Y pKit EGFP ).

Heterozygote c-Kit + /− mice were generated by replacement of the 16 th intron with a PGK-Neo cassette through homologous recombination, resulting in functional inactivation of the gene. A 7 kb BamH1 fragment of the mouse c-Kit gene spanning from intron 14 to intron 17 was utilized to generate by PCR amplification a 1.5 Kb left arm of homology (spanning from intron 14 to exon 16, with an artificial 3′ Xho I site) and a 4.5 Kb right arm of homology (spanning from exon 17 to intron 17, with an artificial 5′ EcoRV site). A Xho I-EcoRV 1.6 Kb PGK-Neo cassette was added upstream to the EcoRV site of the right arm, and a Sal I 3.0 Kb PGK-TK cassette was added to the 3′ Bam H1 site (after partial filling of the Sal I site in the cassette and the Bam H1 site in the right arm). Subsequently, the left arm of homology was added to the Xho I site of the construct. A 11 Kb Not I gene targeting fragment (containing sequentially the left arm of homology, the PGK-Neo cassette, the right arm of homology and the PGK-TK cassette, see Supplementary Figure 1) was electroporated in ES cells, which were subsequently treated with neomycin and gancyclovir for positive and negative selection, respectively. Screening of homologous recombinant ES colonies was performed by Southern blot using a 600 bp EcoRV- Bam H1 external 5′ genomic c-Kit probe and digesting genomic DNA with EcoRV. Positive recombinants were identified by the appearance of a 3 Kb diagnostic band. The identified recombinant ES colonies were injected in mouse blastocysts by standard methods to generate heterozygous mice in which the 1 kb 16th c-Kit intron had been replaced by the 1.6 Kb PGK-Neo cassette. Heterozygote c-Kit +/− mice were crossed with c-Kit TgD814Y c-Kit +/− to generate c-Kit TgD814Y c-Kit +/+ , c-Kit TgD814Y c-Kit +/− or c-Kit TgD814Y c-Kit −/− mice. These mice showed all the typical phenotypic aspects of the White spotting mutation, including lethality in the homozygous condition, are in agreement with previous evidence that the inclusion of a neo gene in intronic sequences severely interferes with the expression of the c-Kit gene. 51

Mice of 1–9 dpp and adults were killed by cervical dislocation. All our investigations conform with the Directive 2010/63/EU of the European Parliament on the protection of animals used for scientific purposes, and were conducted with the approval of the Tor Vergata University's Animal Use for Research Ethic Committee and by the Italian Ministry of Health.

Copy number assay

In order to quantify c-Kit TgD814Y transgene copy number, we performed a real-time PCR assay, based on evaluation of genomic c-Kit sequence from the transgene. Probe and primers were specific for exon 14 of the c-Kit gene.

The c-Kit TgD814Y copy number was determined using TaqMan Copy Number Assays (Life Technologies, Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer's instructions. In brief, genomic DNA (20 ng) was combined with 2 × TaqMan Genotyping Master Mix, TaqMan Copy Number Assay for mouse c-Kit (Mm00161478_cn Cat. # 4400291) and TaqMan Copy Number Reference Assay for mouse Tert in a 20 μ l reaction volume. The assay was performed using the Applied Biosystems I 7500 Fast Real-Time PCR System (Life Technologies, Thermo Fisher Scientific) and the following thermal cycling conditions: 95 °C for 10 min, and 40 cycles of 95 °C for 15 s and 60 °C for 1 min. Samples were assayed using triplicate wells for each gene of interest and copy numbers were estimated by relative quantitation normalized to the known copy number of the reference sequence using the comparative Ct (ΔΔCt) method. The Ct data were subsequently compared with a calibrator sample known to have two copies of the target sequence, analyzed by Applied Biosystems CopyCaller Software (v.2.0; Applied Biosystems) according to the product instruction. Each analysis was carried out with three mice tail DNA of c-Kit +/+ and c-Kit TgD814Y c-Kit +/+ mice. The analysis indicates that transgenic mice integrated one copy of BAC RP23-309C11 construct in genomic DNA. *** P 80% and ΔCq standard deviation between replicates was <0.20.

Newborn cardiac cells isolation, stimulation and immunofluorescence

Cardiac cells were prepared from ventricles of 1–3 dpp newborn pups and cultured as previously described. 52

Freshly isolated newborn cardiac cells, pretreated or not for 30 min with 5 μ M Imatinib-mesylate (sc-202180, Santa Cruz Biotechnology, Inc., Dallas, TX, USA), were stimulated for 10 min with 100 ng/ml KL (R&D Systems, Inc., Minneapolis, MN, USA) before protein extraction.

Immunofluorescence on newborn neonatal myocytes was performed after 24 h of culture. Cells were fixed with 4% PFA, blocked with PBS/0.5% BSA/3% horse serum and stained overnight at 4 °C with mouse anti-sarcomeric myosin (1:5; MF20, Hybridoma Bank, Iowa, IA, USA); rabbit anti-MEF2C (1:100; Abcam: ab64644, Cambridge, UK) and goat anti-c-Kit (1:100; R&D) and then incubated 1 h at 37 °C with anti-rabbit FITC and anti-goat Cy5 secondary antibodies (1:300; Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA). Images were acquired by Nikon Eclipse Ti - S microscope (Nikon Instruments SpA, Firenze, Italy).

Adult CSC purification and differentiation

CSCs were isolated from adult transgenic and wt hearts by enzymatic methods. 35, 40 For CD45 c-Kit + cell purification, myocyte-depleted small cardiac cells were incubated with microbeads conjugated with anti-mouse CD45 antibody (Miltenyi Biotec Srl, Calderara di Reno (BO), Italy) and removed from the preparation by magnetic-activated cell sorting (Miltenyi). From the CD45 fraction, the c-Kit + (CD45 ) cardiac cells were enriched through incubation with a microbeads-conjugated mouse monoclonal antibody against c-Kit (Miltenyi) and separated by magnetic-activated cell sorting.

Freshly isolated CD45 c-Kit + cardiac cells were cultured on gelatin-coated dishes in CSC growth medium 35, 40 before clonogenic, spherogenic and BrdU assays.

Cardiosphere myogenic differentiation was performed as previously described. 35

Endothelial differentiation was obtained by culturing the CSC for 3–10 days in MEM Alpha (Life Technologies), 10% ESQ-FBS (Life Technologies), 1 μ M dexamethasone, 50 μ M/ml ascorbic acid, 10 mM β -glycerophosphate (all from Sigma-Aldrich, Milano, Italy) and 10 ng/ml VEGF (PeproTech EC Ltd., London, UK). LY294002 (10 μ M, Calbiochem, San Diego, CA, USA) and UO126 (10 μ M, Cell Signalling Technology, Danvers, MA, USA) were added to the culture for AKT and ERK1/2 inhibition.

Clonogenic, spherogenic and BrdU assays

To show clonogenicity, single-cell cloning was used through depositing single CD45 c-Kit + cardiac cell into wells of 96-well gelatin-coated Terasaki plates by serial dilution. Individual CD45 c-Kit + cells were grown in mCSFM for 1–3 weeks when clones were identified. 35, 40 The clonogenicity of the CD45 c-Kit + cells was determined by counting the number of wells in each 96-well plate, which contained clones and expressed as a percentage. A total of 10 plates were analyzed for each experiment.

For cardiosphere generation, CD45 c-Kit + CSCs were placed in bacteriological dishes with cardiosphere generation medium (mCSFM) composed of 1:1 ratio of CSC growth medium and Neural Basal Media supplemented with B27 and N2 supplements (Life Tech). Cardiospheres were counted per plate at 14 days and the number expressed as a percentage relative to the number of plated CSCs. 35, 40 For Akt inhibition, MK2206 (Enzo Biochem, New York, NY, USA) was used at a concentration of 1 μ M. For Erk1/2 inhibition, PD98059 (Cell Signaling) was used at a concentration of 100 μ M.

To assess the proliferative activity of c-Kit + CD45 cardiac cells in vitro , 10 μ M bromodeoxyuridine (BrdU, Roche, Monza, Italy) was administered in cell plate for 30 min after 48 h serum-free medium conditions (T0) and every 8 h for 1 day. Then, cells were analyzed by flow cytometry (PE-conjugated Anti-BrdU, eBiosciences, San Diego, CA, USA).

Bone marrow and blood cells isolation

Bone marrow cells were isolated from adult mice by flushing both femurs and tibias with 2 ml of PBS using a 25-gauge needle syringe. Cells were pelleted, washed and re-suspended for the analysis.

For white blood inflammatory and remodeling marker staining, 200 μ l of blood samples were collected from mice eyes in heparin-treated vials then red blood cells were lysated using RBC Lysis Buffer (BioLegend, London, UK) as the protocol.

Анализа проточне цитометрије

Bone marrow cells were re-suspended in FACS buffer (PBS/2% FBS/2 mM EDTA) and stained for 1 h at 4 °C with rat anti-c-Kit CD117 Alexa Fluor 647 (Invitrogen: RM6221, Thermo Fisher Scientific-Life technologies, Waltham, MA, USA) antibody. Dead cells were stained with 7 Amino-Actinomycin D dye (Sigma Aldrich).

White blood cells were stained in 100 μ l of FACS buffer with rat anti-CD11b PE-Cy7 (Pharmingen: 25-0112, Gurgaon, Haryana, India) and rat anti-GR-1 APC antibodies (Pharmingen: 17-5931) at 4 °C for 1 h. Dead cells were stained with Sytox-Blue dye. Analysis was performed with CyAn cytofluorimeter (Dako, Milano, Italy).

Isolated CSC analysis was performed on FACSCanto II with FlowJo software to identify c-Kit expression by mouse monoclonal APC-conjugated anti-c-Kit antibody (Miltenyi). Appropriate labeled isotype controls were used to define the specific gates.

mRNA extraction and RT-PCR analyses

mRNA was extracted from CSCs with Trizol (Sigma Aldrich) using Qiagen RNAEasy miniKit (Milano, Italy) following the manufacturer's instructions. Traces of genomic DNA were removed before retro-transcription using DNA Free Zymo Research kit. RNA was quantitated using a Nanodrop 2000 Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and 0.5–1.0 μ g of total RNA was retro-transcribed using SuperScript II transcriptase (Life Technologies/Invitrogen/Thermo Fisher Scientific) according to the manufacturer's instructions using the High Capacity cDNA Kit (Applied Biosystems).

Reverse transcription-qPCR was performed with the TaqMan Primer/Probe sets (specific primers were purchased from Invitrogen and the relative catalog numbers are available upon request) using StepOne Plus Real Time PCR System (Applied Biosystems) following the manufacturer's instruction.

Data were processed by the ΔCt method using StepOne Software v2.3. mRNA was normalized with GAPDH and all reactions were carried out in triplicate.

For semiquantitative RT-PCR, primers were as follows: CD31 forward 5′- CGAAGTTAGAGTTCTCCTCC-3′ and CD31 reverse 5′- TCTGATACTGCGACAAGACC-3′; VEGFR1 forward, 5′-GGTATGACTTCTGCACTGAG-3′ and VEGFR1 reverse 5′- CACCAATGTGCTAACCGTCT-3′; VEGFR2 forward, 5′-GTGTCTCTTTGCGCTAGGTA-3′ and VEGFR2 reverse, 5′-TTGCCTCACAGAAGACCATG-3′;

Isl1 forward, 5′-GCAGCAACCCAACGACAAAA-3′ and Isl1 reverse, 5′-AATTGACCAGTTGCTGAAAAGC-3′; GAPDH forward 5′-GTGAAGGTCGGTGTGAACG-3′; GAPDH reverse 5′- ATTTGATGTTAGTGGGGTCTCG - 3′. RT-PCR products were separated in a 1% agarose gel stained with ethidium bromide.

Immunoprecipitation and WB analyses

Heart tissue, newborn cardiac cells and CSCs were homogenized into RIPA buffer (150 mmol/l NaCl, 50 mmol/l Tris-HCl pH 7.6, 1% NP40, 0.5% Sodium deoxycholate, 0.1% Sodium dodecyl sulfate, 10 mmol/l β -glicerophosphate, 1mmol/l DTT) containing phosphatase and protease inhibitors before WB analysis as described in Supplementary Methods.

For immunoprecipitation analyses, specific antibodies were incubated with a mixture of protein A and/or G-Sepharose beads (Sigma-Aldrich) in lysis buffer containing 0.05% BSA for 60 min under constant shaking at 4 °C. The beads were then washed twice with lysis buffer and incubated for 90 min at 4 °C with clarified cell lysates under constant shaking. Sepharose beads-bound immunocomplexes were rinsed three times with lysis buffer and eluted with Laemmli buffer. Proteins were separated on SDS-PAGE 8% gels and transferred to PVDF membranes (GE Healthcare, Milano, Italy). These were incubated overnight at 4 °C with rabbit anti-c-Kit (1:100) sc-168; mouse anti-pERK1/2 (1:1000) sc-7383; rabbit anti-ERK 2 (1:1000) sc-154; rabbit anti-pAKT1/2/3-ser473 (1:1000) sc-7985; mouse anti-AKT1/2/3 (1:1000) sc-81434; mouse anti-pTyr (1:1000) Millipore 05-321 (Vimodrone (MI), Italy); mouse anti-tubulin (1:2000) Sigma T 5168 all from Santa Cruz Biotechnology and then with the appropriate horseradish peroxidase-conjugated secondary antibody (Santa Cruz Biotechnology). The horseradish peroxidase conjugate was detected by chemiluminescence with an ECL Kit (Santa Cruz Biotechnology) and autoradiography. Densitometry was performed using Molecular Dynamics Densitometer and ImageJ software.

Protein lysates obtained from CSCs (~50 μ g) were separated on 10% SDS-polyacrylamide gels. After electrophoresis, proteins were transferred onto nitrocellulose filters, blocked with either 5% dry milk or 5% bovine serum albumin, and incubated with Abs against AKT (#9272), p-AKT (#4058 S), ERK1/2 (#9102) and pERK1/2 (#9101) (all from Cell Signaling) at dilutions suggested by the manufacturers. Proteins were detected by chemiluminescence using horseradish peroxidase-conjugated 2Abs and the Alliance UVITEC Cambridge system (Eppendorf, Milano, Italy).

Heart injury

The CI was performed by a technician blinded to the genotype of mice, essentially as previously reported. 45 Briefly, under general anesthesia with Avertin (Sigma, 250 mg/kg), mice were subjected to surgery. The abdominal cavity was opened and CI was inflicted through the intact diaphragm on the heart pushed toward the probe. Heart damage was performed by applying for 5 sa 5 mm diameter metal probe cooled to −196 °C with liquid nitrogen. The abdominal cavity was closed with sutures. Mice received 500 μ l of glucose solution (5% glucose in physiologic solution) and the analgesic Atradol (3 mg/kg), soon after the surgery. Mice were killed and their hearts harvested 3 ( c-Kit +/+ n =2; c-Kit TgD814Y c-Kit +/+ n =2), 9 ( c-Kit +/+ n =10; c-Kit TgD814Y c-Kit +/+ n =8) and 30 ( c-Kit +/+ n =12 and c-Kit TgD814Y c-Kit +/+ n =13) days after the CI.

A set of mice ( c-Kit +/+ n =10; c-Kit TgD814Y c-Kit +/+ n =10) were treated with BrdU for 30 days. Half of them, for each genotype, was damaged with CI as previously described. BrdU (0.6 M) was administered continuously using Alzet osmotic mini pumps (Charles River Laboratories, CALCO (Lecco), Italy). The latter were implanted subcutaneously in the dorsal region via a small interscapular incision using sterile surgical technique, while the animals were under light avertin anesthesia.

Tissue harvesting, immunofluorescence, immunohistochemistry and TUNEL assay

Hearts were collected at different ages, the atria were removed and the ventricles were placed in Hank's balanced solution (Euroclone, Pero (MI), Italy) squeezing gently to remove the remaining blood from the chambers. After washing in PBS, the ventricles were embedded in OCT (Bio-Optica, Milano, Italy), frozen in isopentane chilled with liquid nitrogen and stored at −80 °C before immunohistochemistry and immunofluorescence analyses as described in Supplementary Methods. In order to preserve GFP, ventricles taken from pKit EGFP mice and c-Kit TgD814Y pKit EGFP mice were pre-fixed in PBS/4% PFA pH 7.4 (Sigma) overnight at 4 °C and then included in OCT. Embryos were directly included in OCT, frozen in isopentane chilled with liquid nitrogen and stored at −80 °C.

For EGFP + cardiac cell count, at least 20 sections of 5 μ m thickness were collected from each heart and analyzed for c-Kit and EGFP staining at different postpartum developmental time for pKit EGFP mice and c-Kit TgD814Y pKit EGFP mice: at 1 day n =4 and n =5 mice, respectively; at 10 days n =4 and n =6 mice, respectively; at 2 months old n = 5 and n =6 mice, respectively. Images were acquired with Zeiss microscope (Axioskop 2 plus, Zeiss, Carl Zeiss Microscopy, Thornwood, NY, USA). EGFP-positive cardiac cells were counted throughout the left and right ventricle for each section. The EGFP-positive cell number was calculated as mean number per section.

Immunofluorescence was performed in 5 μ m-thick sections fixed in PBS/4% PFA for 10 min at room temperature before staining. After permeabilization and blocking with PBS/1% BSA, slices were incubated with primary antibodies diluted in PBS/1% BSA overnight at 4 °C. Undamaged and damaged heart sections were stained with the following primary antibodies: goat anti-c-Kit (R&D) 1:100 and rat anti-CD31 (eBioscience: 14-0311) 1:100; rabbit anti- α -SMA (Abcam: ab5694) 1:100. In order to reveal c-Kit receptor in embryos, sections were stained with goat anti-c-Kit (R&D) diluted 1:50. Secondary antibodies anti-rat Alexa Fluor 488, anti-rabbit FITC and anti-goat Cy5 all from Jackson were diluted 1:300. Nuclei were stained by Hoechst 33342 solution.

To quantify fibrotic tissue, trasversal serial sections of ventricles (5 μ m of thickness) were collected, fixed in Bouin solution (Sigma) and stained with Masson's Trichrome kit (Sigma). Collagen was detected in blue and myocardial cells in red. Images were acquired by Axioskop 2 plus, Zeiss microscope and ImageJ software was used to quantify the fibrotic area. The fibrotic residual area of each collected section was measured in pixels and expressed as percentage respect to total area, without the lumen. The injured size was then calculated as the mean percentage of slices for all ventricles.

Apoptosis was evaluated on three heart sections derived from three different c-Kit +/+ and c-Kit TgD814Y c-Kit +/+ mice 9 days after the CI by following TUNEL assay (Roche) manufacturer's instructions.

BrdU, WGA and IB-4 stainings

Damaged hearts from BrdU-treated mice were perfused with buffered formalin and embedded in paraffin, and 5 μ m-thick sections were cut.

Antigen retrieval was achieved using Target Retrieval Solution, Citrate pH 6 (DAKO). Myocyte cytoplasm was detected using an antibody against α -actinin (1:50 dilution, Clone H-300, Santa Cruz Biotechnology) for 3 h at 37 °C and this was detected with anti-rabbit Alexa Fluor 647 (1:100 dilution; Jackson Immunoresearch Laboratories, Inc., West Grove, PA, USA). BrdU was detected using an antibody against BrdU (1:50 dilution; Roche) for 45 min at 37 °C. This antibody was detected with an anti-mouse Alexa Fluor 488 (1:100 dilution; Jackson Immunoresearch). Newly formed myocytes were detected through double staining for BrdU and α -actinin. Secondary antibody incubation was carried out at 37 °C for 1 h. Wheat germ agglutinin (Alexa Fluor 594 conjugate WGA; Life Technologies) staining was performed for cardiomyocyte dimension analysis. The nuclei were counterstained with the DNA-binding dye, 4, 6-diamidino-2-phenylindole (Sigma) at 1 μ g/ml. Sections were mounted in Vectashield and analyzed and scanned using confocal microscopy (Leica Microsystems TCS SP5, Milano, Italy). ImageJ software was used to quantify the cardiomyocyte area.

For IB-4 staining, 5 μ m heart sections were deparaffinized and treated with 10 mM sodium citrate solution (Santa Cruz Biotechnology), pH 6.0, in microwave for 10 min. After permeabilization with 0.1% PBS-Triton X-100 v/v at RT for 8 min, sections were blocked with PBS-1% BSA w/v for 30 min at RT and capillaries were stained with IB-4 - FITC conjugated (Sigma) overnight at 4 °C. Nuclei were stained with Hoechst 33342. Slides were mounted with glycerol in 50 mM Tris-HCl solution pH 8.7 (1:1). Images were acquired by Nikon Eclipse Ti - S microscope. The number of capillary was counted in 10 images/section and reported as fold change.

статистичке анализе

Statistical analysis was performed with GraphPad Prism version 6.00 for Macintosh (GraphPad Software, Inc., La Jolla, CA, USA). Quantitative data are reported as mean±SE or mean±SD and binary data by counts. Significance between two groups was determined by Student's t test or paired t test as appropriate. For comparison between multiple groups, ANOVA was used. Вредност П <0, 05 се сматра значајном. Bonferroni post hoc method was used to locate the differences. In these cases, the type 1 error ( α =0.05) was corrected by the number of statistical comparisons performed. If not specified, a n =4 sample size was used for the in vitro cell and molecular biology experiments. The Kruskal–Wallis (for multiple‐group comparison) and the Mann–Whitney U tests (for comparison between two groups) were performed.

Додатне информације

ПДФ датотеке

  1. 1.

    Додатне информације

Речник

ЦИ

cryoinjury

ЦСЦ-ови

cardiac stem cells

IB-4

isolectin B4

КЛ

c-Kit ligand

Додатне информације прате овај рад на веб локацији Целл Деатх анд Дисеасе (//ввв.натуре.цом/цддис)